CRISPRscreen

  


* Email:


Description:


* Sequence [eg. CAGAGTATGAGATAGAGAGGTCGTTCTTTCTTCGAATGAAATGTGTCTTGGCGAAAAGGAACGCGGGCCTGACCTGCAGCGGATACA]:


Organism:


Seed-sequence length:
13bp   12bp  

Protospacer-adjacent motif (PAM):
SP:   NGG   NAG   NGG or NAG
NM:   NNNNGANN   NNNNGTTN   NNNNGNNT
ST1:   NNAGAA   NNAGGA   NNGGAA
TD:   NAAAAN  







* = required.